커뮤니케이션 생물학 6권, 기사 번호: 646(2023) 이 기사 인용
896 액세스
22 알트메트릭
측정항목 세부정보
질병 매개 모기인 Aedes albopictus 및 Aedes aegypti에 대한 화학적 통제는 비용이 많이 들고, 지속 불가능하며, 살충제 저항성의 확산으로 인해 점점 더 효과적이지 않습니다. 멸균 곤충 기술은 귀중한 대안이지만 느리고 오류가 발생하기 쉬우며 낭비적인 성 분리 방법으로 인해 제한됩니다. 여기서 우리는 m 및 M 성 유전자좌에 연결된 형광 마커를 기반으로 4개의 유전적 성감별 균주(각 Aedes 종에 대해 2개)를 제시하여 형질전환 수컷을 분리할 수 있습니다. 또한, 우리는 이러한 성감별 계통을 결합하여 비형질전환 수컷의 생산을 어떻게 가능하게 하는지 보여줍니다. 대량 사육 시설에서는 단일 기계에서 약 0.01~0.1%의 암컷 오염으로 100,000마리의 첫 번째 수컷 유충을 1.5시간 이내에 분류할 수 있습니다. 비용 효율성 분석에 따르면 이러한 균주를 사용하면 대량 사육 시설을 설정하고 운영하는 동안 상당한 비용 절감 효과를 얻을 수 있는 것으로 나타났습니다. 전체적으로, 이러한 유전적 성별 구분 균주는 이러한 중요한 벡터에 대한 제어 프로그램의 대규모 확장을 가능하게 해야 합니다.
Aedes aegypti와 Aedes albopictus는 뎅기열(DENV), 치쿤구니야(CHIKV), 지카(ZIKV) 및 황열병(YFV) 바이러스를 포함한 많은 병원체의 전염을 담당하는 침입성 모기 종입니다1,2. 기후 변화와 전 세계 무역으로 인해 두 매개체 모두 빠르게 확산되고 있으며, 효과적인 통제 조치가 없다면 2050년까지 세계 인구의 49%가 숲모래 매개 질병의 위험에 처할 것으로 예상됩니다3,4.
유전자 제어를 사용하여 모기 개체수를 억제하는 것은 살충제 사용에 대한 가장 효과적이고 지속 가능하며 환경 친화적인 대안 중 하나입니다. 이는 무는 수컷 모기의 반복적인 대량 방출에 의존합니다. 무균(Sterile Insect Technique, SIT5 및 pgSIT6을 포함한 그 파생물), Wolbachia 감염(호환되지 않는 곤충 기술, IIT7,8,9), 둘 다10,11 또는 치명적인 이식유전자를 운반(RIDL, Dominant Lethal을 운반하는 곤충 방출)12. 이러한 모든 개입에는 효율적인 성 분리 방법이 필요합니다. 현재 Aedes 모기는 완전 수동13,14 또는 부분 자동화11일 수 있는 Hoch 분류기를 사용하여 자연 번데기 크기 이형성을 기반으로 성별을 구분합니다. 균질한 번데기 크기와 그에 따른 밀도 최적화된 애벌레 양육 조건이 필요한 이 방법은 0.8~1% 사이의 암컷 오염률과 높은 일일 및 사용자 간 변동성15으로 어려움을 겪고 있습니다. 특히, 1.13 × 10-7%의 암컷 오염을 허용하는 다단계 번데기 및 성체 분류기가 최근에 설명되었습니다9. 그러나 다른 모든 기존 방법과 마찬가지로 이 시스템은 후기 단계에서 분류하고 양육된 수컷의 절반 미만을 회수한다는 단점을 공유합니다. 즉, 총 번데기의 >75%가 사육되고 먹이를 먹인다는 의미입니다.
Anopheles 모기에서는 어린 유충의 자동 성 분리를 허용하는 형질전환 유전적 성감별 균주(GSS)가 설명되었습니다16,17,18,19. 형광 마커는 남성 특이적 조절 서열을 사용하거나 마커를 Y 염색체에 연결하여 남성 특이적 발현을 표시합니다. Anopheles coluzzii 성분별 계통 중 하나는 X-연결되어 있어 암컷이 수컷보다 더 형광성을 띠게 됩니다. 성 분리는 형광에 따라 큰 입자를 분류하는 유세포 분석기 역할을 하는 COPAS(복합 개체 매개변수 분석기 및 분류기) 장치를 사용하여 수행됩니다. 또한, 형질전환 수컷 방출에 대한 대안으로 COPAS를 사용하여 비형질전환 수컷 전용 집단을 생성하는 교배 계획이 제안되었습니다. 이 계획에는 Y 염색체에 형광 마커를 운반하는 계통과 X 염색체에 형광 마커를 운반하는 계통이 필요합니다. 첫 번째 계통의 비형질전환(X-/X-) 암컷을 두 번째 계통의 형질전환(X+/Y-) 수컷과 교배하면 형질전환(X+/X-) 암컷과 비형질전환(X-/Y)으로 구성된 자손이 탄생합니다. −) 수컷.
120 piggyBac random insertions (Fig. 1d). The best m-linked insertion line that we obtained showed a recombination frequency of 0.1%. Its transgenic cassette harboured a Cas9 transgene associated with a DsRed fluorescence marker and was flanked by lox sites. A Cas9 transgene being undesirable in a sexing strain, we excised it using CRE recombinase and replaced it with an eGFP transgene. This Ae. albopictus m-linked strain was termed Aal-m. Sequencing of the transposon’s flanking genomic sequence indicated that it had landed into a highly repeated region; hence, its exact genomic location could not be identified but matched several loci in 1q31 (see Methods and Supplementary Data 1). Both Ae. albopictus transgenic lines show a clear sex-separation pattern in COPAS analyses (Fig. 1c, d). All four lines were fluorescence-sorted and screened at each generation. In the Aaeg-M line, a single recombination event was visually recorded after 15 generations (>10,000 individuals screened in total). Consequently, we estimated that the Aaeg-M and Aaeg-m lines recombine at approximately 0.01%. In Aal-M, four recombinant individuals were observed in the tenth generation after successively screening a total of >50,000 individuals. These recombinations are likely to have arisen from a single event, suggesting that recombination is extremely rare in the Aal-M strain as well./p>$50,000 savings at 20 M males/week and above, Fig. 5e). In total, considering construction, equipment, diet and consumable costs, GSS is predicted to be the most economical option at all tested throughputs, while GSS-CS starts to be more economical compared to manual sorting of pupae from a 10 M males/week throughput (Fig. 5f). Moreover, the workload, the cost of which can only be estimated on a country-by-country basis, is reduced by 29–38% with GSS and 18–27% with GSS-CS (Fig. 5g). For all comparisons, including equipment cost, the most expensive option is the automated sorting of pupae, as the devices are expensive (e.g. $40k for the automated sorter from11, J. Bouyer) and the number of insects to be reared is high (Fig. 5b–g)./p>20,000 screened larvae), we later injected the repair donor plasmid (190 ng/µL) with 5 µM Scr7 and three plasmids expressing different gRNAs under the control of different AeU6 promoters (70 ng/µL each plasmid). This method gave significantly higher knock-in rates (25 GFP positive larvae out of about 4000 screened)./p>20,000 G1 larvae screened, a single transgenic male larva was found, raised to adulthood, and crossed to WT females. Its progeny was composed of 100% eGFP positive sons and 100% eGFP negative daughters, indicative of M linkage. We termed this Ae. aegypti M-linked strain Aaeg-M. Upon injection of 600 BgR9 eggs with the pX3 repair plasmid and a mixture of three plasmids expressing gRNAs (GTGGCATAGCGCCGTGTGGA[GGG], GTCTTAAATGAAAGAGGCG[AGG], GTATCATGCGTATTGCGAG[AGG], brackets indicate the PAM) under the control of three different U6 promoters (gRNA cloning vectors: Supplementary Data 4), 43 larvae with transient eGFP expression were recovered in G0. Resulting 20 males and 20 females were crossed en masse to adults of the opposite sex. 25 transgenic G1 larvae were obtained, 10 of which were males carrying an M-linked insertion, 4 were males carrying an m-linked insertion and 11 were females carrying an m-linked insertion. Proper insertion site in AAEL019619 was confirmed by PCR in all tested individuals, which revealed that in some of these mosquitoes the whole repair plasmid had integrated. From a single male devoid of the plasmid backbone, an Ae. aegypti m-linked strain named Aaeg-m was established and further characterized. Both Aaeg-M and Aaeg-m lines were backcrossed into a Brazilian (Bra) genetic background for 7 generations./p>700 individuals screened in each line until the sixth generation (Supplementary Table 3). Most other M-linked lines also showed 100% fluorescent males but contained additional, non-M-linked multiple insertions and were discarded. Based on line fitness and COPAS profiles, we selected a YFP line termed Aal-M for further work as an Ae. albopictus M-linked strain. Additional M-linked lines marked with OpIE2-GFP or Pub-DsRed showing no recombination to date, carrying a docking attP site for subsequent transgenesis, and representing additional GSSs are also being maintained to date but were not further characterized in detail./p>120 random piggyBac insertions. For this, we screened our existing collection of Ae. albopictus transgenic lines for m/M-linkage and constructed an additional library of piggyBac constructs expressing various fluorescence proteins (eGFP, mTurquoise2, YFP or DsRed) under the control of promoters showing distinct expression patterns (3xP3, OpIE2, Ae. aegypti PUb, Drosophila melanogaster actin5C). By performing multiplex injections of these piggyBac plasmids together, we obtained lines carrying up to six distinct insertions as indicated by their colours and patterns of fluorescence. Out of 40 independent founder transgenic individuals screened (most of which carrying multiple insertions), only two insertions appeared m-linked: one carried an OpIE2-mTurquoise2 marker gene with a recombination rate of about 3%, and the other, called m-albR9, carried a Cas9 transgene with a DsRed reporter gene and showed a recombination rate of 0.1%. We exploited the latter, in which transgenes are flanked by two lox sites adjacent to an attP docking site. We injected m-albR9 eggs with a plasmid encoding Cre recombinase to excise Cas9 and DsRed transgenes, as Cas9 is undesirable in a GSS. From successfully excised individuals, we established an m-linked attP docking line, mX1, carrying no further transgene. In a second step, an attB-containing plasmid carrying a PUb-eGFP marker cassette was integrated into the attP site. The m-linkage of this new strain was verified by crossing eGFP males to WT females and screening their offspring. The new Ae. albopictus m-linked line, named Aal-m was made hemi/homozygous and amplified./p>
한국어
English
Français
Deutsch
Español
Italiano
Português
日本語
Русский